Liraglutide can reverse memory impairment, synaptic loss and reduce plaque load in aged APP/PS1 mice, a model of Alzheimer's disease
Introduction
Type 2 diabetes (T2DM) has been identified as a risk factor for Alzheimer disease (AD) (Hoyer, 2004, Hölscher, 2005, Craft, 2007, Perry et al., 2007). Impaired insulin signalling has been linked to cerebral degenerative processes in aged T2DM patients (Zhao et al., 2004) and AD patients (Ohara et al., 2011) and insulin receptor desensitisation is observed in the Alzheimer's disease brain (Craft, 2007, Talbot et al., 2012). The desensitisation could play a role in the development of neurodegenerative disorders, as insulin is a growth factor with neuroprotective properties (Gasparini et al., 2002, Hoyer, 2004, Holscher, 2011).
GLP-1 is an incretin hormone (Lovshin and Drucker, 2009). Currently, the GLP-1 receptor agonists exendin-4 (Exenatide, Byetta®), liraglutide (Victoza®) and lixisenatide (Lyxumia®) are approved for treatment of T2DM (Lovshin and Drucker, 2009, Wohlfart et al., 2013). These analogues are injected subcutaneously and are well tolerated.
GLP-1 also acts as a growth factor in the brain, and has been shown to induce neurite outgrowth and to protect against oxidative injury (Perry et al., 2007). Furthermore, mice that overexpress GLP-1 receptors in the hippocampus exhibited increased neurite growth and improved learning (During et al., 2003). The deletion of the GLP-1 receptor impairs learning and of developing long-term potentiation of synaptic transmission (LTP) in the hippocampus (Abbas et al., 2009). Moreover, Liraglutide and exendin-4 have been shown to reduce endogenous levels of beta-amyloid in the brain (Perry et al., 2003, McClean et al., 2011). GLP-1 analogues induce the proliferation of neuronal progenitor cells in the brains of mice (During et al., 2003, Hunter and Holscher, 2012). This induction of cell proliferation has the potential to facilitate the repair of neuronal networks in cortical tissue and could have beneficial effects in patients with AD (Greenberg and Jin, 2006). We have previously shown that injection of Val(8)GLP-1 ip. for 3 weeks rescued LTP in the hippocampus of a APP/PS1 mouse model of AD (Gengler et al., 2012). Importantly, GLP-1 and GLP-1 analogues cross the blood brain barrier (BBB) (Kastin et al., 2002, Perry and Greig, 2002, McClean et al., 2011, Gengler et al., 2012, Hunter and Holscher, 2012). Our recent work testing liraglutide in 7–9 month old APPswe/PS1ΔE9 mice demonstrated that at an intermediate stage of disease progression, when mice are beginning to display behavioural deficits, 8 weeks treatment with liraglutide ip. improved learning and memory, enhanced LTP, reduced beta amyloid plaque load and chronic inflammation, reduced total levels of APP and toxic oligomers (McClean et al., 2011). Building on this encouraging study, the current study aims to address whether liraglutide has restorative effects at a late stage of disease progression with a high amyloid plaque load, memory and synaptic failure and synaptic loss, or only when taken at an early stage to prevent further deterioration. Accordingly, 16 month-old APPswe/PS1ΔE9 and wild-type mice were tested after having been injected ip. with liraglutide for 8 weeks. We analysed the effects on memory, synaptic plasticity of hippocampus, synaptic density, plaque deposition and inflammation, neurogenesis in dentate gyrus, and levels of total APP and soluble aggregated beta amyloid.
Section snippets
Animals
APPswe/PS1ΔE9 mice with a C57Bl/6 background were obtained from the Jackson lab (http://research.jax.org/repository/alzheimers.html). Heterozygous males were bred with wild-type C57/Bl6 females bought locally (Harlan, UK). Offspring were ear punched and genotyped using PCR with primers specific for the APP-sequence (Forward “GAATTCCGACATGACTCAGG”, Reverse: “GTTCTGCTGCATCTTGGACA”). For details see Gengler et al. (2010). Mice not expressing the transgene were used as wild-type controls. Male
Object recognition memory is restored by liraglutide treatment in aged APP/PS1 mice
Path length, speed and anxiety measures in the open field, after a single administration of liraglutide (25 nmol/kg bw) or saline 30 min prior to introduction to the apparatus, were similar in liraglutide and saline-treated wild-type and APP/PS1 mice (data not shown). In an object recognition task the acute response to administration of Liraglutide or saline was assessed (30 min prior to exposure to open field on day 1 and 30 min before exposure to familiar object on day 2). A one-way ANOVA of
Discussion
The aim of this study was to assess whether liraglutide could have a restorative effect on the pathophysiology of Alzheimer's disease progression in 14–16 month-old APP/PS1 mice, given the recent findings demonstrating a preventive effect after two months liraglutide-treatment from age 7–9 months in APP/PS1 mice, in improving cognition and reducing many AD-associated biomarkers (McClean et al., 2011). The results presented here demonstrate that ten weeks liraglutide treatment results in
Acknowledgements
This project was funded by Alzheimer's Society (grant number 97) with support from The Henry Smith Charity. We thank Prof. P Flatt and Dr. VA Gault the UU diabetes research group for advice and support.
Dr. Holscher is a named inventor on a patent application by Ulster University for the use of GLP-1 analogues in neurodegenerative diseases.
References (52)
- et al.
Impairment of synaptic plasticity and memory formation in GLP-1 receptor KO mice: interaction between type 2 diabetes and Alzheimer's disease
Behavioural Brain Research
(2009) - et al.
Synaptic release rather than failure in the conditioning pulse results in paired-pulse facilitation during minimal synaptic stimulation in the rat hippocampal CA1 neurones
Neuroscience Letters
(1996) - et al.
Applications of the Morris water maze in the study of learning and memory
Brain Research. Brain Research Reviews
(2001) - et al.
Abeta oligomers induce neuronal oxidative stress through an N-methyl-d-aspartate receptor-dependent mechanism that is blocked by the Alzheimer drug memantine
The Journal of Biological Chemistry
(2007) - et al.
Does insulin dysfunction play a role in Alzheimer's disease?
Trends in Pharmacological Sciences
(2002) - et al.
Val(8)GLP-1 rescues synaptic plasticity and reduces dense core plaques in APP/PS1 mice
Neurobiology of Aging
(2012) Glucose metabolism and insulin receptor signal transduction in Alzheimer disease
European Journal of Pharmacology
(2004)- et al.
Slow degradation of aggregates of the Alzheimer's disease amyloid beta-protein by microglial cells
The Journal of Biological Chemistry
(1997) - et al.
Evidence of GLP-1-mediated neuroprotection in an animal model of pyridoxine-induced peripheral sensory neuropathy
Experimental Neurology
(2007) - et al.
Insulin, insulin-degrading enzyme and amyloid-beta peptide in Alzheimer's disease: review and hypothesis
Neurobiology of Aging
(2006)
Using paired-pulse facilitation to probe the mechanisms for long-term potentiation
Journal of Physiology (Paris)
Clearing the brain's amyloid cobwebs
Neuron
Seizures induced by GABAB-receptor blockade in early-life induced long-term GABA(B) receptor hypofunction and kindling facilitation
Epilepsy Research
Insulin and the insulin receptor in experimental models of learning and memory
European Journal of Pharmacology
Insulin receptor dysfunction impairs cellular clearance of neurotoxic oligomeric a{beta}
The Journal of Biological Chemistry
Insulin resistance and Alzheimer-like reductions in regional cerebral glucose metabolism for cognitively normal adults with prediabetes or early type 2 diabetes
Archives of Neurology
Neural stem cells improve cognition via BDNF in a transgenic model of Alzheimer disease
Proceedings of the National Academy of Sciences of the United States of America
An anti-diabetes agent protects the mouse brain from defective insulin signaling caused by Alzheimer's disease-associated Abeta oligomers
The Journal of Clinical Investigation
Amyloid-associated neuron loss and gliogenesis in the neocortex of amyloid precursor protein transgenic mice
The Journal of Neuroscience: The Official Journal of the Society for Neuroscience
Sniffing neuropeptides: a transnasal approach to the human brain
Nature Neuroscience
Role of the brain-derived neurotrophic factor at glutamatergic synapses
British Journal of Pharmacology
Effects of brain-derived neurotrophic factor on optic axon branching and remodelling in vivo
Nature
Insulin resistance and Alzheimer's disease pathogenesis: potential mechanisms and implications for treatment
Current Alzheimer Research
Protection of synapses against Alzheimer's-linked toxins: insulin signaling prevents the pathogenic binding of Abeta oligomers
Proceedings of the National Academy of Sciences of the United States of America
Role of the blood-brain barrier in the pathogenesis of Alzheimer's disease
Current Alzheimer Research
Apolipoprotein E, amyloid-beta, and blood-brain barrier permeability in Alzheimer disease
Journal of Neuropathology and Experimental Neurology
Cited by (256)
Does gut brain axis has an impact on Parkinson's disease (PD)?
2024, Ageing Research ReviewsAntidiabetic agents as a novel treatment for Alzheimer's and Parkinson's disease
2023, Ageing Research ReviewsAlternative role of glucagon-like Peptide-1 receptor agonists in neurodegenerative diseases
2023, European Journal of PharmacologyCitation Excerpt :The effects of GLP-1 analogs could potentially improve neuronal connectivity and cognitive impairments in patients with AD. Other mechanisms contribute to the beneficial effects of liraglutide, including increasing formation of neuronal progenitor and stem cells (Hamilton et al., 2011; Parthsarathy and Holscher, 2013); reducing activated microglial numbers and extent of neuroinflammation, including late-stage AD mice (McClean and Holscher, 2014a; Paladugu et al., 2021); promoting autophagy via the AMPK/mTOR (Kong et al., 2018); improving mitochondrial function through the cAMP/PKA pathway in astrocytes and supporting neuronal survival (Xie et al., 2021); decreasing oxidative stress and lipid peroxidation levels by upregulating superoxidase dismutase and glutathione peroxidase (An et al., 2021); reducing oxidative/nitrosative stress and inflammation (Duarte et al., 2020); decreasing iron overload and oxidative stress (An et al., 2021); increasing the expression of Bcl-2; and reducing the expression of Bax with reduced hyperphosphorylated tau protein and Akt/GSK-3β signaling pathway in human SH-SY5Y cells under oxidative stress (Zheng et al., 2019). The benefits of liraglutide have been demonstrated in various AD models, such as Aβ1-42 intracerebroventricular injection (Qi et al., 2016); aged APP/PS1 mice (McClean and Holscher, 2014a); senescence-accelerated mouse prone eight mice (Hansen et al., 2015); various DM models, including streptozotocin-induced AD model (Xiong et al., 2013); hyperhomocysteinemia-induced AD-like pathology (Zhang et al., 2019b); 5xFAD mouse models of AD (Paladugu et al., 2021); and infusion of amyloid-β oligomers into the intracerebroventriculum of macaques (Batista et al., 2018).
Protective role of IGF-1 and GLP-1 signaling activation in neurological dysfunctions
2022, Neuroscience and Biobehavioral ReviewsThe gut microbiota modulate locomotion via vagus-dependent glucagon-like peptide-1 signaling
2024, npj Biofilms and MicrobiomesLiraglutide Reduces Alcohol Consumption, Anxiety, Memory Impairment, and Synapse Loss in Alcohol Dependent Mice
2024, Neurochemical Research